pegfp constructs  (New England Biolabs)

Journal: bioRxiv

Article Title: Role of a childhood cancer-linked BRIP1/FANCJ germline variant in genomic instability and cancer cell vulnerability

doi: 10.64898/2026.03.24.714005

Figure Lengend Snippet: a, Representative confocal microscopy images of HCT116 cells stably expressing BRIP1 WT or BRIP1 R162Q, proceed by indirect immunofluorescence staining with the G-quadruplex–specific BG4 antibody. BG4 was detected through sequential incubation with anti-FLAG and fluorophore-conjugated secondary antibodies. Nuclei were stained with TO-PRO-3. Scale bar, 20 µm. b, Quantification of nuclear G4 foci numbers in BRIP1 WT and BRIP1 R162Q expressing HCT116 cells. Minimum number of 100 nuclei analyzed per condition. Data represent the mean ± SEM from three independent experiments. two-tailed paired t-test was performed (**p < 0.001). c, Increased load of R-loop formation in BRIP1 R162Q variant expressing cells. Representative confocal microscopy images of HCT116 cells expressing BRIP1 WT or BRIP1 R162Q. d, Quantification of nuclear R-loop, shown as mean fluorescence intensity (MFI) of S9.6 signal per nucleus, measured with ImageJ. At least 150 nuclei per condition were analyzed in each replicate (n = 3 independent experiments). Data are presented as mean ± SEM. Statistical significance was determined by two-tailed paired t-test (**p < 0.001). e, Treatment with 10 U of recombinant RNaseH1 per coverslip abolished the S9.6 signal. R-loop staining was performed using the S9.6 antibody. Cells were fixed with cold methanol/acetone, and nuclei were counterstained with TO-PRO-3. Scale bar, 20 µm.

Article Snippet: The RNaseH1 constructs (pEGFP-RNaseH1 WT, Addgene #108699; and RNaseH1 D145N-EGFP) were kindly provided by Brian Luke (Institute of Molecular Biology, Mainz).

Techniques: Confocal Microscopy, Stable Transfection, Expressing, Immunofluorescence, Staining, Incubation, Two Tailed Test, Variant Assay, Fluorescence, Recombinant

Journal: bioRxiv

Article Title: Role of a childhood cancer-linked BRIP1/FANCJ germline variant in genomic instability and cancer cell vulnerability

doi: 10.64898/2026.03.24.714005

Figure Lengend Snippet: a, HCT116 cells stably expressing BRIP1 R162Q were transiently transfected using PEI with empty vector (EV-EGFP) or RNaseH1-WT-eGFP. Transfection efficiency was assessed via EGFP fluorescence. b, immunoblot analysis confirming expression of GFP-tagged constructs in transfected cells. c, Immunofluorescence detection of R-loops using the S9.6 antibody in cells transfected with EGFP or EGFP-RNaseH1. d, Quantification of S9.6 mean fluorescence intensity (MFI) per nucleus. Data represent mean ± SEM of three independent experiments. e, Immunofluorescence detection of G-quadruplex (G4) structures using the BG4 antibody in cells transfected with EGFP or EGFP-RNaseH1. f, Quantification of BG4 fluorescence intensity per nucleus. Data represent mean ± SEM of three independent experiments. g, Representative DNA fiber assay images from HCT116 cells harboring BRIP1 R162Q transfected with empty vector (EV-eGFP) or RNaseH1-WT. DNA replication tracts were sequentially labeled with CldU (red) and IdU (green). h, Quantification of DNA fiber types. RNaseH1-WT expression reduced the proportion of stalled replication forks in cells harboring BRIP1 R162Q. i, While the overall fork speed was not significantly increased upon RNaseH1-WT expression, tracts displayed a more balanced distribution of CldU and IdU incorporation. j, Fork asymmetry analysis. RNaseH1-WT expression reduced fork asymmetry, indicating that left- and right-moving sister forks progressed at more similar speeds. Labeled tracks were visualized by confocal microscopy, and tract lengths were measured on raw LSM images. Lengths (µm) were converted to replication speed (kb/min) using a factor of 2.59 kb/µm. All data represent mean ± SEM from three independent experiments. At least 150 fibers per condition were analyzed in each replicate. Statistical significance was determined using paired two-tailed Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001, ns = not significant). c, e, Representative confocal images are shown.

Article Snippet: The RNaseH1 constructs (pEGFP-RNaseH1 WT, Addgene #108699; and RNaseH1 D145N-EGFP) were kindly provided by Brian Luke (Institute of Molecular Biology, Mainz).

Techniques: Stable Transfection, Expressing, Transfection, Plasmid Preparation, Fluorescence, Western Blot, Construct, Immunofluorescence, Labeling, Confocal Microscopy, Two Tailed Test

Journal: bioRxiv

Article Title: Role of a childhood cancer-linked BRIP1/FANCJ germline variant in genomic instability and cancer cell vulnerability

doi: 10.64898/2026.03.24.714005

Figure Lengend Snippet: a, BRIP1 R162Q cells show increased sensitivity to ATR inhibition. Representative colony formation assays and quantification of HCT116 cells expressing BRIP1 WT, BRIP1 R162Q, or BRIP1 knockout (KO) treated with increasing doses of the ATR inhibitor VE-822. Cells were treated overnight and colonies were allowed to form for 10 days prior to crystal violet staining. b, Quantification of survival fraction following ATR inhibition by VE-822. c, BRIP1 R162Q expressing cells show increased sensitivity to DNA-PK inhibition. Representative colony formation assays and quantification following overnight treatment with increasing doses of the DNA-PK inhibitor NU7441. d, Quantification of survival fraction following DNA-PK inhibition using NU7441 e, BRIP1 R162Q cells show increased sensitivity to treatment with G4-stabilizer Pyridostatin. Representative colony formation assays following overnight treatment with increasing concentrations of Pyridostatin (PDS) are shown. After drug removal, cells were cultured for 10 days before fixation and staining. f, Quantification of surviving fraction following Pyridostatin treatment b,d,f , Quantification was performed using EagleEye analysis software. Data represent the mean ± SD of three independent biological replicates. g, Schematic representation of the workflow used to perform colony formation assays in BRIP1R162Q cells upon R-loop removal by ectopic RNaseH1 expression. BRIP1 R162Q cells were transfected with RNase H1 WT or catalytically inactive RNaseH1 D145N, re-seeded, and treated the next day with the drugs indicated. Colonies were stained with crystal violet after 10 days . h-k, RNaseH1 expression decreases sensitivity to ATR VE-822 ( h,i, ) and DNA-PK NU7441 ( j,k, ) inhibition in BRIP1 R162Q expressing cells. h,j, Show representative colony formation plates and i, k, show quantifications of clonogenic survival. Data represent mean values ± SEM from three biologically independent experiments. Colony formation was quantified using EagleEye analysis software.

Article Snippet: The RNaseH1 constructs (pEGFP-RNaseH1 WT, Addgene #108699; and RNaseH1 D145N-EGFP) were kindly provided by Brian Luke (Institute of Molecular Biology, Mainz).

Techniques: Inhibition, Expressing, Knock-Out, Staining, Cell Culture, Software, Transfection

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a Experimental scheme for in vitro DNA pull-downs. b Whole cell extracts (WCE) from WT-MEF were incubated with streptavidin beads alone (mock) or with streptavidin beads-bound biotinylated dsDNA (b-dsDNA) or ssDNA (b-ssDNA) prior to in vitro DNA pull-down. Input and eluates were analyzed by Western blot (WB) using the indicated antibodies. c As in a , except that WCE from WT-RAW264.7 were used. d In vitro pulldown was performed as in c , except that beads-bound biotinylated dsRNA were also used. e In vitro pulldown was performed as in b , except that two different b-dsDNA were used. f Experimental scheme for in-cell DNA pulldowns. g WT-MEF were transfected with b-dsDNA or not (mock) before WCE preparation and streptavidin-affinity pull-down. Input and eluates were analyzed by WB using the indicated antibodies. h As in g , except that WCE were from WT-RAW264.7 cells transfected or not with b-dsDNA. i Immunofluorescence analysis was conducted on WT-MEF transfected or not with dsDNA for 6 h using anti-MeCP2 antibody, anti-dsDNA antibody and DAPI nuclear staining. BF, bright field. Images are representative of 3 independent experiments. Scale bar: 10 µm, except for Zoom: 5 µm. j Violin plots show the % MeCP2 intensity in the cytosol in experiments performed as in i ( n = 123 for Mock and for 120 dsDNA-transfected cells). k Pearson’s correlation coefficient was calculated on the cytosolic dsDNA and MeCP2 signals in WT-MEF treated as in j . l Immunofluorescence analysis of WT-MEF transfected or not with dsDNA and ssDNA for 6 h was performed using anti-MeCP2 antibody (enhanced signal or not) and DAPI nuclear staining. BF, bright field. Scale bars: 10 µm; Scale bars for Zoomed images: 5 µm. Images are representative of 3 independent experiments. m Violin plots show the % MeCP2 intensity in the cytosol and nucleus in experiments performed as in l ; n = 105 cells per condition. WB and images are representative of at least 3 independent experiments. Significance was assessed using two-sided Student t-test. ns: non-significant. * P < 0.05, ** P < 0.01, and **** P < 0.0001. Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: In Vitro, Incubation, Western Blot, Transfection, Immunofluorescence, Staining

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a WT-MEF were stimulated with dsDNA for 3, 6, and 16 h prior to immunofluorescence analyses using an MeCP2 targeting antibody and DAPI nuclear staining. Scale bars: 10 µm. b Violin plots show the number of MeCP2 foci intensity in the cytosol and in the nucleus in experiments performed as in a ; n > 50 cells per condition. c Immunofluorescence analysis was performed on WT-MEF treated or not with 20 nM of Leptomycin B (LMB) prior to dsDNA transfection for 3 h using anti-MeCP2 antibody (enhanced signal or not) and DAPI nuclear staining. Scale bars: 10 µm; Scale bar for Zoomed images: 5 µm. Images are representative of two independent experiments. d Violin plots show the % of MeCP2 intensity in the cytosol and nucleus in cells treated as in c ; n = 95 cells per condition. e Immunofluorescence analysis was conducted on WT-MEF and MEF cGas−/− cells transfected or not with dsDNA for 6 h using anti-MeCP2 antibody, anti-dsDNA antibody and DAPI nuclear staining. BF, bright field. Images are representative of 3 independent experiments. Scale bar: 20 µm. f Immunofluorescence analysis was performed on WT-MEF and MEF Trex1-/- using anti-MeCP2 antibody and DAPI nuclear staining. Scale bars: 20 µm. Images are representative of two independent experiments. g Violin plots show the % of MeCP2 intensity in the cytosol and nucleus of cells treated as in f , n = 97 cells per condition. Significance was assessed using a two-sided Student t -test. Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: Immunofluorescence, Staining, Transfection

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a Immunofluorescence analysis was conducted on MEF stably expressing a EGFP-cGAS construct (MEF EGFP-cGAS ) transfected or not with dsDNA for 6 h using anti-MeCP2 antibody and DAPI nuclear staining. Images are representative of 3 independent experiments. Scale bar: 20 µm; Scale bar for Zoom: 10 µm. (Right) Graph presents mean ± SEM. b Pearson’s correlation coefficient values for co-localization of cGas and MeCP2. p values were determined by Student’s t test. **** p < 0.0001; n = 12. c WT-MEF were transfected or not for 10 min, 30 min, 1 h, 3 h or 6 h with b-dsDNA before whole-cell extract preparation and pull-down using streptavidin-affinity beads. Input and eluates were analyzed by WB using the indicated antibodies. d WT-MEF were transfected or not with dsDNA before whole-cell extract preparation and immunoprecipitation using control IgG or a MeCP2-specific antibody. Input and immunoprecipitated material were analyzed by WB using the indicated antibodies. e MeCP2 knockout RAW264.7 were engineered to stably express FLAG-tagged MeCP2 prior to stimulation with dsDNA for 1, 3, 6 and 16 h. Whole cell extracts were subjected to FLAG immunoprecipitation prior to analysis of inputs and eluates by WB using the indicated antibodies. f Whole cell extracts prepared from WT-MEF or MEF cGas-/- cells were incubated with streptavidin beads alone or with streptavidin bead-bound b-dsDNA prior to pull-down. Input and eluates were analyzed by WB using the indicated antibodies. g Whole cell extracts prepared from MEF expressing a control non-targeting gRNA (MEF gCTRL ) or a MeCP2-targeting gRNA (MEF gMecp2 ) were incubated with streptavidin beads alone or with streptavidin bead-bound b-dsDNA prior to pull-down. Input and eluates were analyzed by WB using the indicated antibodies. All WB are representative of 3 independent experiments. Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: Immunofluorescence, Stable Transfection, Expressing, Construct, Transfection, Staining, Immunoprecipitation, Control, Knock-Out, Incubation

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a Immunofluorescence analysis was conducted on MEF gCTRL or MEF gMecp2 after challenge or not with dsDNA for 6 h, using anti-cGas antibody and DAPI nuclear staining. Scale bar: 20 µm. Images are representative of 3 independent experiments. b Intracellular 2’3’-cGAMP levels were measured by ELISA following transfection or not with the dsDNA of MEF gCTRL or MEF gMecp2 . Graph presents fold increase 2’3’-cGAMP levels from 5 independent experiments. c MEF gCTRL or MEF gMecp2 were challenged or not with dsDNA for 6 h prior to gene expression analyses. Graph presents mean (±SEM) Ifnβ , Cxcl10 , Il6 and Isg15 mRNA levels ( n = 3 independent experiments). d MEF gCTRL or MEF gMecp2 were challenged with dsDNA for 24 h prior to collection of the supernatant and analyses using proteome profiler antibody arrays. The heat map presents data obtained from duplicate measurements. e representative images of arrays from d . f MEF gCTRL or MEF gMecp2 were challenged or not with dsDNA for 6 h in the presence or not of the H-151 Sting inhibitor. Graphs present mean (±SEM) Ifnβ , Il6 , Ccl5 , Oas1 , and Ifit2 mRNA levels and mean centroid analysis ( n = 3 independent experiments). One-way ANOVA with Sidak’s multiple comparison. g MEF overexpressing WT-MeCP2 (eMeCP2) or not (Empty) were transfected or not with dsDNA for 6 h prior to analysis of Ifnβ , Il6 , Cxcl10 , and Mecp2 mRNA levels. Graphs present mean (±SEM) from 3 independent experiments. h MEF gCTRL or MEF gMecp2 were challenged or not with poly(I:C) for 6 h prior to gene expression analyses. Graphs present mean (±SEM) Ifnβ , Oasl1 , Cxcl10 , and Isg15 mRNA levels ( n = 3 independent experiments). Significance was assessed using a two-sided Student t -test, except when otherwise stated. Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: Immunofluorescence, Staining, Enzyme-linked Immunosorbent Assay, Transfection, Gene Expression, Comparison

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a Experimental scheme for b – h. b WT-MEF infected or not with a GFP-expressing HSV-1 KOS64 at 0.5 or 5 multiplicity of infection (MOI) were analyzed by immunofluorescence using anti-MeCP2 antibody and DAPI nuclear staining. Images are representative of 3 independent experiments. Scale bar: 50 µm. c Percent MeCP2 intensity in the cytosol in cells infected as in ( b ); n = 30 cells per condition. d As in c , except that cells were infected with the EGFP-expressing HSV-1 McKrae at 1 MOI; n > 50 cells per condition. e MEF gCTRL or MEF gMecp2 were infected or not with 5 MOI of HSV-1-KOS64 for 6 and 16 h prior to analysis of expression of indicated genes. Graphs present the mean (±SEM) of 3 independent experiments. f Mean (±SEM) plaques per cm2 after 72 h of infection of MEF gCTRL or MEF gMecp2 with 1 MOI of HSV-1 KOS64. 8 replicates, representative of 3 independent experiments. g WT-MEF were infected with conditioned media from HSV-1 KOS64-infected MEF gCTRL or MEF gMecp2 . The graph presents the mean (±SEM) percentage GFP-positive cells in recipient cells ( n = 3 independent experiments). h Representative images of cells in g . Scale bar: 400 µm. i Gene Set Enrichment Analysis (GSEA) was performed looking for Biological Process on DESeq2 results (log2foldchange > 0.01. GSEA p -value cut off = 0.05) from RNAseq data from RAW264.7 gCTRL or RAW264.7 gMecp2 . j Gene expression analysis was performed in the livers of male Mecp2 +/y and Mecp2 -/y mice. Graph presents mean (±SEM) fold increase gene expression in Mecp2 -/y mice as compared to Mecp2 +/y ; n = 4 mice per group. k Mean centroid expression was calculated on the expression of genes indicated in j ( n = 4 mice per group). l Significant DEGs involved in inflammation, interferon-beta, virus response, STING, and innate immunity between hippocampi from control and Mecp2 -silenced mice. X-axis: the False Discovery Rate (FDR). Gene symbols are reported for genes relevant to innate immunity. m Example Gene Set upregulated in patients with severe RTT symptoms. Significance was assessed using a two-sided Student T-test except for h , j and k . Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: Infection, Expressing, Immunofluorescence, Staining, Gene Expression, Virus, Control